Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249883

Morpholino Name: mau2 MO1
Synonyms: KIAA0892, TGas066o14, XtKIAA0892
Target mRNA: mau2

Morpholino Type: uncategorized morpholino
Sequence: 5' CGTAGCCGCCATCACTGACATCAAC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' GTTGATGTCAGTGATGGCGGCTACG 3' ||||||||||||||||||||||||| 3' CAACTACAGTCACTACCGCCGATGC 5' 5' GTTGATGTCAGTGATGGCGGCTACG 3' ||||||||||||||||||||||||| 3' CAACTACAGTCACTACCGCCGATGC 5' 5' GTTGATGTCAGTGATGGCGGCTACG 3' ||||||||||||||||||||||||| 3' CAACTACAGTCACTACCGCCGATGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 Scaffold21:1909851..1909875 25/25 Antisense target mau2.S
chr1L:110543977..110544001 25/25 Antisense target mau2.L
chr2S:158905855..158905879 21/25 Antisense off-target trim39l.1.S
tropicalis 10.0 Chr1:113794703..113794727 25/25 Antisense target mau2
Chr9:90883797..90883821 21/25 Antisense off-target ccdc93
Publications
First: Metazoan Scc4 homologs link sister chromatid cohesion to cell and axon migration guidance., PLoS Biol 2006                  
Most recent: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
View All Papers