Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249884

Morpholino Name: mbd2 MO1
Synonyms: MO3, MO3 (1381-1405)
Target mRNA: mbd2

Morpholino Type: uncategorized morpholino
Sequence: 5' AAGTGCAAGATACACACATACAAAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/25
genomic

MO
5' TTTTGTATGTGTGTACTTTGCTTTT 3' ||||||||||||||| |||| || 3' AAAACATACACACATAGAACGTGAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:19957746..19957770 25/25 Antisense off-target dnd1.L
chr9_10S:76141475..76141499 22/25 Antisense off-target mob4.S
chr1L:127981713..127981737 21/25 Sense off-target Xelaev18006878m
chr1L:41805631..41805655 21/25 Antisense off-target cep44.L
chr2L:89553315..89553339 21/25 Antisense off-target LOC108708284
chr5L:120173597..120173621 21/25 Antisense off-target XB5965330.L [provisional]
chr5L:132344494..132344518 21/25 Antisense off-target LOC108717159 [provisional:epha3]
chr7L:13031661..13031685 21/25 Antisense off-target reep3.L
chr9_10S:71941649..71941673 21/25 Antisense off-target bmpr2.S
chr3L:126438100..126438124 21/25 Antisense off-target Xelaev18018907m
chr3S:48611711..48611735 21/25 Antisense off-target LOC108712901 [provisional:nnt]
Scaffold28:2291284..2291308 21/25 unknown
chr1L:213605371..213605395 21/25 unknown
chr4S:24539357..24539381 21/25 unknown
chr5L:13812711..13812735 21/25 unknown
chr6L:143802982..143803006 21/25 unknown
chr2S:80003416..80003440 21/25 unknown
chr3S:102985089..102985113 21/25 unknown
tropicalis 10.0 Chr1:203607568..203607592 21/25 Antisense target mbd2
Chr1:3347968..3347992 21/25 Antisense off-target LOC100492345
Chr1:46032191..46032215 21/25 Sense off-target tenm3
Chr2:116229430..116229454 21/25 Antisense off-target mcf2l
Chr3:57623275..57623299 21/25 Sense off-target msrb3
Chr5:59144994..59145018 21/25 Sense off-target ust
Chr6:27356338..27356362 21/25 Antisense off-target nebl
Chr6:80417094..80417118 21/25 Antisense off-target cdh18
Chr1:107326413..107326437 21/25 unknown
Chr1:57830549..57830573 21/25 unknown
Chr7:12459852..12459876 21/25 unknown
Chr8:79618883..79618907 21/25 unknown
Chr4:122211219..122211243 21/25 unknown
Chr6:82658113..82658137 21/25 unknown
Publications
First: Participation of Xenopus Elr-type proteins in vegetal mRNA localization during oogenesis., J Biol Chem 2009    
Most recent: Elr-type proteins protect Xenopus Dead end mRNA from miR-18-mediated clearance in the soma., Proc Natl Acad Sci U S A 2010                
View All Papers