Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249885

Morpholino Name: mbd3 MO1
Synonyms: xMBD3
Target mRNA: mbd3

Morpholino Type: uncategorized morpholino
Sequence: 5' AGCACTCCCATCGCTTTTTCTCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATGGAGAAAAAGCGATGGGAGTGCT 3' ||||||||||||||||||||||||| 3' TACCTCTTTTTCGCTACCCTCACGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1S:83845597..83845621 25/25 Antisense target mbd3.S
Publications
First: Xenopus MBD3 plays a crucial role in an early stage of development., Dev Biol 2004                            
Most recent:
View All Papers