Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249886

Morpholino Name: mctp2 MO1
Synonyms:
Target mRNA: mctp2

Morpholino Type: uncategorized morpholino
Sequence: 5' TCTGTAGTTCTACATTAGGAAGGAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25
genomic

MO
5' TTCCTTCCTAATGTAGAACTACAGA 3' ||||||||||||||||||||||||| 3' AAGGAAGGATTACATCTTGATGTCT 5' 5' TTCCTTCCTAATATAGAACTACAGA 3' |||||||||||| |||||||||||| 3' AAGGAAGGATTACATCTTGATGTCT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:103683330..103683354 25/25 Antisense target mctp2.L
chr3S:40204567..40204591 24/25 Antisense target mctp2.S
chr4S:64734782..64734806 22/25 unknown
chr1L:39716916..39716940 21/25 unknown
tropicalis 10.0 Chr2:37704612..37704636 21/25 Sense off-target nlgn4x
Chr4:148003125..148003149 21/25 Antisense off-target arf4
Chr4:37074846..37074870 21/25 Sense off-target LOC100491634
Chr7:75008359..75008383 21/25 Antisense off-target robo4
Publications
First: MCTP2 is a dosage-sensitive gene required for cardiac outflow tract development., Hum Mol Genet 2013  
Most recent:
View All Papers