Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249887

Morpholino Name: mctp2 MO2
Synonyms:
Target mRNA: mctp2

Morpholino Type: uncategorized morpholino
Sequence: 5' GCGGAAATAATTTGATCATACTTGT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25
genomic

MO
5' ACAAGTATGATCAAATTATTTCCGC 3' ||||||||||||||||||||||||| 3' TGTTCATACTAGTTTAATAAAGGCG 5' 5' ACAAGTATGATCAAATGATTTCCAC 3' |||||||||||||||| |||||| | 3' TGTTCATACTAGTTTAATAAAGGCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:103682681..103682705 25/25 Antisense target mctp2.L
chr3S:40205163..40205187 23/25 Antisense target mctp2.S
tropicalis 10.0 Chr9:4801801..4801825 21/25 Sense off-target LOC100487628
Chr9:4801801..4801825 21/25 Antisense off-target LOC108645245
Chr9:11335649..11335673 21/25 unknown
Publications
First: MCTP2 is a dosage-sensitive gene required for cardiac outflow tract development., Hum Mol Genet 2013  
Most recent:
View All Papers