Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249888

Morpholino Name: mdfic MO1
Synonyms: XIC MO, XIC morpholino
Target mRNA: mdfic

Morpholino Type: uncategorized morpholino
Sequence: 5' GGGACATCTGCCAGGCCTCTCAGCA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' TGCTGAGAGGCCTAGCAGATGTCCC 3' ||||||||||||| ||||||||||| 3' ACGACTCTCCGGACCGTCTACAGGG 5' 5' TGCTGAGAGGCCTGGCAGATGTCCC 3' ||||||||||||||||||||||||| 3' ACGACTCTCCGGACCGTCTACAGGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3S:79389519..79389543 25/25 Antisense target mdfic.S
chr3L:58804077..58804101 25/25 Antisense off-target LOC108711134 [provisional:mdfic]
tropicalis 10.0 Chr3:67462803..67462827 24/25 Antisense target mdfic
Chr7:20783199..20783223 21/25 Antisense off-target inpp5a.1
Publications
First: XIC is required for Siamois activity and dorsoanterior development., Mol Cell Biol 2005  
Most recent:
View All Papers