Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249889

Morpholino Name: mecp2 MO1
Synonyms: MeCP2 morpholino oligo ( MMO )
mRNA Target: mecp2

Morpholino Type: uncategorized morpholino
Sequence:
5' CGCAGCGGCCATTTTCTCTCGTGCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
tropicalis 10.0 Chr3:23634678..23634702 21/25 Sense off-target atp10b
Chr8:40781665..40781689 21/25 Antisense off-target ngrn
Chr8:40781665..40781689 21/25 Sense off-target vsig4
Publications
First: A mutant form of MeCP2 protein associated with human Rett syndrome cannot be displaced from methylated DNA by notch in Xenopus embryos., Mol Cell 2003                            
Most recent:
View All Papers