Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249889

Morpholino Name: mecp2 MO1
Synonyms: MeCP2 morpholino oligo ( MMO )
mRNA Target: mecp2

Morpholino Type: uncategorized morpholino
Sequence:
5' CGCAGCGGCCATTTTCTCTCGTGCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
tropicalis 7.1 scaffold_3:62076803..62076827 21/25 unknown
scaffold_8:22376214..22376238 21/25 Sense off-target vsig4
Publications
First: A mutant form of MeCP2 protein associated with human Rett syndrome cannot be displaced from methylated DNA by notch in Xenopus embryos., Mol Cell 2003                            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556