Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249890

Morpholino Name: med15 MO1
Synonyms: XARC105 MO
mRNA Target: med15

Morpholino Type: uncategorized morpholino
Sequence:
5' CAACACCTGCTTTCCTCATTGCTTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25
genomic

MO
5' GAAGCTATGAGGAAAGCTGGTGTTG 3' ||||| ||||||||||| ||||||| 3' CTTCGTTACTCCTTTCGTCCACAAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold162663:648730..648754 25/25 Antisense off-target Xelaev16018015m
Scaffold97703:42793..42817 25/25 Antisense off-target Xelaev16080231m
Scaffold22127:4322066..4322090 22/25 Sense off-target Xelaev16028959m
Scaffold271680:783394..783418 21/25 unknown
Scaffold325141:666383..666407 21/25 Antisense off-target akr1a1.L
tropicalis 7.1 scaffold_1:55149236..55149260 23/25 Antisense target med15
scaffold_1:55171332..55171356 23/25 Antisense target med15
scaffold_166:178772..178796 22/25 unknown
scaffold_8:58898358..58898382 21/25 unknown
Publications
First: A component of the ARC/Mediator complex required for TGF beta/Nodal signalling., Nature 2002  
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556