Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249893

Morpholino Name: mef2d MO1
Synonyms: Mef2dMO, xMEF2D MO
mRNA Target: mef2d

Morpholino Type: uncategorized morpholino
Sequence:
5' AATCTGGATCTTTTTTCTGCCCATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' CATGGGGAGGAAAAAGATCCAGATT 3' |||||| || ||||||||||||||| 3' GTACCCGTCTTTTTTCTAGGTCTAA 5' 5' CATGGGCAGAAAAAAGATCCAGATT 3' ||||||||||||||||||||||||| 3' GTACCCGTCTTTTTTCTAGGTCTAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold41091:2864621..2864645 25/25 Antisense target mef2d.S
Scaffold26819:2514151..2514175 24/25 Antisense off-target Xelaev16036267m
Scaffold122663:987771..987795 22/25 unknown
Scaffold32212:499326..499350 22/25 Antisense off-target Xelaev16042755m
Scaffold1187:3114406..3114430 21/25 unknown
Scaffold169907:1233329..1233353 21/25 Sense off-target Xelaev16020138m
Scaffold249035:884267..884291 21/25 unknown
Scaffold314296:286478..286502 21/25 unknown
tropicalis 7.1 scaffold_27:108126..108150 23/25 Antisense target mef2d
scaffold_1:28839351..28839375 22/25 Antisense off-target mef2c
scaffold_2:30272506..30272530 22/25 unknown
scaffold_8:96385131..96385155 22/25 unknown
scaffold_3:91327839..91327863 21/25 Antisense off-target usp15
scaffold_7:21775892..21775916 21/25 unknown
scaffold_7869:80..104 21/25 unknown
scaffold_9:93972812..93972836 21/25 unknown
Publications
First: Nemo-like kinase-myocyte enhancer factor 2A signaling regulates anterior formation in Xenopus development., Mol Cell Biol 2007  
Most recent: Comparative analysis reveals distinct and overlapping functions of Mef2c and Mef2d during cardiogenesis in Xenopus laevis., PLoS One 2014                
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556