Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249894

Morpholino Name: mef2d MO2
Synonyms: XMEF2D
mRNA Target: mef2d

Morpholino Type: uncategorized morpholino
Sequence:
5' GGATCTTTTTTCTGCCCATGATTCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' GGAATCATGGGGAGGAAAAAGATCC 3' ||||||||||| || |||||||||| 3' CCTTAGTACCCGTCTTTTTTCTAGG 5' 5' GGAATCATGGGCAGAAAAAAGATCC 3' ||||||||||||||||||||||||| 3' CCTTAGTACCCGTCTTTTTTCTAGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold41091:2864616..2864640 25/25 Antisense target mef2d.S
Scaffold26819:2514156..2514180 23/25 Antisense off-target Xelaev16036267m
Scaffold169907:1233324..1233348 22/25 Sense off-target Xelaev16020138m
Scaffold102974:19271167..19271191 21/25 unknown
Scaffold16863:10381211..10381235 21/25 unknown
Scaffold277614:1822701..1822725 21/25 unknown
tropicalis 7.1 scaffold_27:108131..108155 23/25 Antisense target mef2d
scaffold_1950:8993..9017 21/25 unknown
scaffold_4:113031755..113031779 21/25 Sense off-target wdr59
scaffold_8:69442256..69442280 21/25 unknown
Publications
First: Transcriptional regulation of mesoderm genes by MEF2D during early Xenopus development., PLoS One 2013                  
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556