Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249895

Morpholino Name: meis3 MO1
Synonyms: Meis3-MO, XMeis3, XMeis3 AMO
mRNA Target: meis3

Morpholino Type: uncategorized morpholino
Sequence:
5' ATACCTTTGTGCCATTCCGAGTTGG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 21/25 22/25
genomic

MO
5' CCGACTCGGAATGGCACAAAGGGTA 3' || ||||||||||||||||||| 3' GGTTGAGCCTTACCGTGTTTCCATA 5' 5' CCAACTCGGAATGGCACAAAGGGTA 3' |||||||||||||||||||||| 3' GGTTGAGCCTTACCGTGTTTCCATA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold39723:8700782..8700806 22/25 Antisense target meis3.L
Scaffold221007:2514533..2514557 21/25 Antisense off-target Xelaev16028806m
Scaffold50079:3219667..3219691 21/25 unknown
tropicalis 7.1 scaffold_8:65832865..65832889 21/25 Antisense target meis3
Publications
First: A Meis family protein caudalizes neural cell fates in Xenopus., Mech Dev 1999            
Most recent: A novel function for Egr4 in posterior hindbrain development., Sci Rep 2015                    
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556