Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249899

Morpholino Name: mid1 MO1
Synonyms: xMID-Mo
mRNA Target: mid1

Morpholino Type: uncategorized morpholino
Sequence:
5' CAGTTCAGACTCCAGTGTTTCCATC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GATGGAAACACTGGAGTCTGAACTG 3' ||||||||||||||||||||||||| 3' CTACCTTTGTGACCTCAGACTTGAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold137317:3364879..3364903 25/25 Antisense off-target Xelaev16011272m
Scaffold371923:168544..168568 24/25 Antisense off-target Xelaev16048343m
Scaffold36864:3987118..3987142 23/25 Antisense off-target Xelaev16047988m
Scaffold146311:3251794..3251818 21/25 unknown
Scaffold27161:7861282..7861306 21/25 Antisense off-target Xelaev16037186m
Scaffold93786:109392..109416 21/25 unknown
tropicalis 7.1 scaffold_2:45658083..45658107 25/25 Antisense target mid1
scaffold_8:21070791..21070815 23/25 unknown
scaffold_8:21996225..21996249 23/25 Antisense off-target mid2
scaffold_10:28230816..28230840 22/25 unknown
scaffold_1:99128397..99128421 21/25 unknown
Publications
First: MID1 and MID2 are required for Xenopus neural tube closure through the regulation of microtubule organization., Development 2010                                                        
Most recent: Mechanical roles of apical constriction, cell elongation, and cell migration during neural tube formation in Xenopus., Biomech Model Mechanobiol 2016                
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556