Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249900

Morpholino Name: mid1ip1 MO1
Synonyms: Mig12 MO, Mig12-Mo
mRNA Target: mid1ip1

Morpholino Type: uncategorized morpholino
Sequence:
5' TTTCCTTCAATAGTACAAATGGTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold137317:2619217..2619240 24/24 Antisense off-target Xelaev16011259m
Scaffold219188:606920..606943 21/24 unknown
Scaffold230550:3798107..3798130 21/24 unknown
Scaffold26819:205296..205319 21/24 unknown
Scaffold28973:64..87 21/24 unknown
Scaffold1187:9714441..9714464 20/24 Antisense off-target Xelaev16004948m
Scaffold5925:8867902..8867925 20/24 unknown
tropicalis 7.1 scaffold_3:27463466..27463489 20/24 unknown
scaffold_9:3703857..3703880 20/24 unknown
Publications
First: Identification of novel ciliogenesis factors using a new in vivo model for mucociliary epithelial development., Dev Biol 2007                                            
Most recent: MID1 and MID2 are required for Xenopus neural tube closure through the regulation of microtubule organization., Development 2010                                                        
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556