Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249903

Morpholino Name: mix1 MO1
Synonyms: mix.1
mRNA Target: mix1

Morpholino Type: uncategorized morpholino
Sequence:
5' AAAGCAGGAATCCTACCTACCTAAG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
tropicalis 7.1 scaffold_7:70814176..70814200 21/25 unknown
Publications
First: Mix.1/2-dependent control of FGF availability during gastrulation is essential for pronephros development in Xenopus., Dev Biol 2008                    
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556