Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249915

Morpholino Name: mos MO1
Synonyms: Mos MO, Mos antisense morpholino, c-Mos, c-mos mo, mos
mRNA Target: mos

Morpholino Type: uncategorized morpholino
Sequence:
5' AAGGCATTGCTGTGTGACTCGCTGA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TCAGCGAGTCACACAGCAATGCCTT 3' ||||||||||||||||||||||||| 3' AGTCGCTCAGTGTGTCGTTACGGAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold58038:4052535..4052559 25/25 Antisense target mos.L
Publications
First: Mos is not required for the initiation of meiotic maturation in Xenopus oocytes., EMBO J 2002  
Most recent: Control of Cdc6 accumulation by Cdk1 and MAPK is essential for completion of oocyte meiotic divisions in Xenopus., J Cell Sci 2015  
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.3


Major funding for Xenbase is provided by grant P41 HD064556