Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249916

Morpholino Name: mos MO2
Synonyms: p39Mos
Target mRNA: mos

Morpholino Type: uncategorized morpholino
Sequence: 5' GGGAAGGCATTGCTGTGTGACTCGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GCGAGTCACACAGCAATGCCTTCCC 3' ||||||||||||||||||||||||| 3' CGCTCAGTGTGTCGTTACGGAAGGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6L:116464778..116464802 25/25 Antisense target mos.L
Publications
First: Differential roles of p39Mos-Xp42Mpk1 cascade proteins on Raf1 phosphorylation and spindle morphogenesis in Xenopus oocytes., Dev Biol 2005  
Most recent:
View All Papers