Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249919

Morpholino Name: msi1 MO1
Synonyms: musashi1
mRNA Target: msi1

Morpholino Type: uncategorized morpholino
Sequence:
5' GCGCTTCTGTCTCCATTCGGTCTCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' AGAGACCGAATGGAGACTGAAGCGC 3' ||||||||||||||||| ||||||| 3' TCTCTGGCTTACCTCTGTCTTCGCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold36586:190857..190881 25/25 Antisense off-target Xelaev16047590m
Scaffold113816:591368..591392 24/25 Antisense target msi1.S
Scaffold208071:4527532..4527556 21/25 unknown
Scaffold83691:1941041..1941065 21/25 Antisense off-target chrne.L
tropicalis 7.1 scaffold_1:56296061..56296085 25/25 Antisense off-target msi2
Publications
First: Visual activity regulates neural progenitor cells in developing xenopus CNS through musashi1., Neuron 2010  
Most recent: Autoregulation of Musashi1 mRNA translation during Xenopus oocyte maturation., Mol Reprod Dev 2012  
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556