Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249921

Morpholino Name: msx1 MO1
Synonyms: Msx1 MO, Msx1-MO, Msx1MO
mRNA Target: msx1

Morpholino Type: uncategorized morpholino
Sequence:
5' GCCATACAGAGAGATCCGAGCTGAG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 25/25 25/25
genomic

MO
5' CCCAGCTCGGATATCTCTGTATGGC 3' | |||||||||| |||||||||||| 3' GAGTCGAGCCTAGAGAGACATACCG 5' 5' CTCAGCTCGGATCTCTCTGTATGGC 3' ||||||||||||||||||||||||| 3' GAGTCGAGCCTAGAGAGACATACCG 5' 5' CTCAGCTCGGATCTCTCTGTATGGC 3' ||||||||||||||||||||||||| 3' GAGTCGAGCCTAGAGAGACATACCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold106356:582083..582107 25/25 Antisense target msx1.L
Scaffold146311:2157441..2157465 25/25 Antisense target msx1.S
Scaffold285865:282463..282487 21/25 Antisense off-target Xelaev16038685m
tropicalis 7.1 scaffold_1:193641371..193641395 23/25 Antisense target msx1
scaffold_8:4281626..4281650 21/25 Sense off-target surf6
Publications
First: Msx1 and Pax3 cooperate to mediate FGF8 and WNT signals during Xenopus neural crest induction., Dev Cell 2005              
Most recent: A gene regulatory network underlying the formation of pre-placodal ectoderm in Xenopus laevis., BMC Biol 2018                              
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556