Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249922

Morpholino Name: msx1 MO2
Synonyms: Msx1-MO
mRNA Target: msx1

Morpholino Type: splice blocking morpholino
Sequence:
5' TATAGGGTCAACTTACTTGTTGGG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 20/24 24/24
genomic

MO
5' CCCAACAAGTAAGTTGACTGTGTT 3' |||||||||||||||||| | | 3' GGGTTGTTCATTCAACTGGGATAT 5' 5' CCCAACAAGTAAGTTGACCCTATA 3' |||||||||||||||||||||||| 3' GGGTTGTTCATTCAACTGGGATAT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold146311:2157856..2157879 24/24 Antisense target msx1.S
Scaffold139741:130271..130294 21/24 unknown
Scaffold237598:2781752..2781775 21/24 unknown
Scaffold373158:2214715..2214738 21/24 Antisense off-target timp2.L
Scaffold106356:582492..582515 20/24 Antisense target msx1.L
Scaffold14978:2274905..2274928 20/24 unknown
tropicalis 7.1 scaffold_1:153557885..153557908 21/24 unknown
scaffold_10:17978815..17978838 21/24 unknown
scaffold_6:132756723..132756746 21/24 Antisense off-target scn5a
scaffold_6:2168892..2168915 21/24 unknown
scaffold_7:75005321..75005344 21/24 unknown
scaffold_1:8560326..8560349 20/24 Sense off-target depdc1b
scaffold_10:7914888..7914911 20/24 unknown
scaffold_23:162993..163016 20/24 unknown
scaffold_3b:3608381..3608404 20/24 unknown
scaffold_6:119948861..119948884 20/24 unknown
scaffold_6:69773264..69773287 20/24 unknown
scaffold_79:341808..341831 20/24 unknown
Publications
First: Msx1 and Msx2 have shared essential functions in neural crest but may be dispensable in epidermis and axis formation in Xenopus., Int J Dev Biol 2006            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556