Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249923

Morpholino Name: msx1 MO3
Synonyms: Msx1, Msx1-MO
mRNA Target: msx1

Morpholino Type: uncategorized morpholino
Sequence:
5' CATACAGAGAGATCCGAGCTGAGAA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' TTCTCAGCTCGGATCTCTCTGTATG 3' ||||||||||||||||||||||||| 3' AAGAGTCGAGCCTAGAGAGACATAC 5' 5' TTCTCAGCTCGGATCTCTCTGTATG 3' ||||||||||||||||||||||||| 3' AAGAGTCGAGCCTAGAGAGACATAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold106356:582081..582105 25/25 Antisense target msx1.L
Scaffold146311:2157439..2157463 25/25 Antisense target msx1.S
Publications
First: Neural crest determination by co-activation of Pax3 and Zic1 genes in Xenopus ectoderm., Development 2005            
Most recent: Hairy2-Id3 interactions play an essential role in Xenopus neural crest progenitor specification., Dev Biol 2008                            
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556