Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249930

Morpholino Name: myc MO1
Synonyms: Xc-Myc, Xc-Myc1
Target mRNA: myc

Morpholino Type: uncategorized morpholino
Sequence: 5' CATCTTTCCTGCCATGCGATTGGTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 25/25
genomic

MO
5' GACCACTCGGAGGGCAGGAAAGATG 3' ||||| ||| | ||||||||||||| 3' CTGGTTAGCGTACCGTCCTTTCTAC 5' 5' GACCAATCGCATGGCAGGAAAGATG 3' ||||||||||||||||||||||||| 3' CTGGTTAGCGTACCGTCCTTTCTAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6S:118709014..118709038 25/25 Antisense target myc.S
chr6L:143183628..143183652 22/25 Antisense target myc.L
chr6L:129757242..129757266 23/25 Antisense off-target vps13b.L
chr9_10S:93343576..93343600 22/25 Sense off-target amdhd2.S
Publications
First: A Myc-Slug (Snail2)/Twist regulatory circuit directs vascular development., Development 2008                
Most recent:
View All Papers