Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249931

Morpholino Name: myc MO2
Synonyms: c-myc, c-myc MO
Target mRNA: myc

Morpholino Type: uncategorized morpholino
Sequence: 5' TGGGAAAATTGGCGTTAAGAGGCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25 24/25
genomic

MO
5' ATGCCTCTTAATGCCAATTTCCCCA 3' ||||||||||| |||||||| |||| 3' TACGGAGAATTGCGGTTAAAAGGGT 5' 5' ATGCCTCTTAACGCCAATTTTCCCA 3' ||||||||||||||||||||||||| 3' TACGGAGAATTGCGGTTAAAAGGGT 5' 5' ATGCCTCTTAATGCCAATTTTCCCA 3' ||||||||||| ||||||||||||| 3' TACGGAGAATTGCGGTTAAAAGGGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6L:143183650..143183674 25/25 Antisense target myc.L
chr6S:118709036..118709060 24/25 Antisense target myc.S
chr7S:69308964..69308988 22/25 unknown
tropicalis 10.0 Chr6:141201234..141201258 23/25 Antisense target myc
Publications
First: The protooncogene c-myc is an essential regulator of neural crest formation in xenopus., Dev Cell 2003          
Most recent: Using myc genes to search for stem cells in the ciliary margin of the Xenopus retina., Dev Neurobiol 2012                        
View All Papers