Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249933

Morpholino Name: mycn MO1
Synonyms: N-myc
Target mRNA: mycn

Morpholino Type: uncategorized morpholino
Sequence: 5' GATTTCTGCTCACCAACCCTGGCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 24/25
genomic

MO
5' ATGCCAGGGTTGGTGAGCAGAAACC 3' ||||||||||||||||||||||| | 3' TACGGTCCCAACCACTCGTCTTTAG 5' 5' ATGCCAGGGTTGGTGAGCAGAAATC 3' ||||||||||||||||||||||||| 3' TACGGTCCCAACCACTCGTCTTTAG 5' 5' ATGCCAGGGTTGGTGAGCAGAAATA 3' |||||||||||||||||||||||| 3' TACGGTCCCAACCACTCGTCTTTAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5L:141162483..141162507 25/25 Antisense target mycn.L
chr5S:121934130..121934154 24/25 Antisense target mycn.S
chr5L:73568717..73568741 21/25 Sense off-target LOC108716797
chr7L:102490141..102490165 21/25 Antisense off-target megf8.L
chr7S:75648234..75648258 21/25 Antisense off-target megf8.S
chr9_10S:75671083..75671107 21/25 unknown
tropicalis 10.0 Chr5:140984817..140984841 24/25 Antisense target mycn
Publications
First: The protooncogene c-myc is an essential regulator of neural crest formation in xenopus., Dev Cell 2003          
Most recent: Using myc genes to search for stem cells in the ciliary margin of the Xenopus retina., Dev Neurobiol 2012                        
View All Papers