Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249936

Morpholino Name: myh10 MO1
Synonyms: MHC-B, MHC-B MO
mRNA Target: myh10

Morpholino Type: uncategorized morpholino
Sequence:
5' CTTCCTGCCCTGGTCTCTGTGACAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATGTCACAGAGACCAGGGCAGGAAG 3' ||||||||||||||||||||||||| 3' TACAGTGTCTCTGGTCCCGTCCTTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold163806:3264360..3264384 25/25 Antisense target myh10.S
Scaffold81941:811073..811097 24/25 unknown
Scaffold113759:1145734..1145758 21/25 unknown
Scaffold137358:64..88 21/25 unknown
Scaffold15436:6422956..6422980 21/25 unknown
Scaffold45452:196476..196500 21/25 Sense off-target Xelaev16055105m
tropicalis 7.1 scaffold_2:117040023..117040047 22/25 unknown
scaffold_18:1215763..1215787 21/25 unknown
scaffold_5:5345297..5345321 21/25 unknown
scaffold_5:88994633..88994657 21/25 unknown
Publications
First: Convergence and extension at gastrulation require a myosin IIB-dependent cortical actin network., Development 2008    
Most recent: Decoupling the Roles of Cell Shape and Mechanical Stress in Orienting and Cueing Epithelial Mitosis., Cell Rep 2019                
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556