Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249937

Morpholino Name: myh10 MO2
Synonyms:
mRNA Target: myh10

Morpholino Type: uncategorized morpholino
Sequence:
5' CTTCCTGCCCTGGTCTCTGTACAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 20/24
genomic

MO
5' TGTCACAGAGACCAGGGCAGGAAG 3' |||||||||||||||||||| 3' TACATGTCTCTGGTCCCGTCCTTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold44780:1021296..1021319 21/24 unknown
Scaffold46073:124870..124893 21/24 unknown
Scaffold125077:643466..643489 20/24 Antisense off-target Xelaev16006855m
Scaffold163806:3264361..3264384 20/24 Antisense target myh10.S
Scaffold253725:117..140 20/24 unknown
Scaffold46002:414739..414762 20/24 unknown
Scaffold74695:201..224 20/24 unknown
Scaffold91950:2384668..2384691 20/24 Antisense off-target cdan1.L
tropicalis 7.1 scaffold_7:44432109..44432132 21/24 unknown
scaffold_3:21406456..21406479 20/24 unknown
scaffold_33:166907..166930 20/24 unknown
scaffold_8:13893795..13893818 20/24 unknown
Publications
First: Morphogenetic movements driving neural tube closure in Xenopus require myosin IIB., Dev Biol 2009      
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556