Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249940

Morpholino Name: myh6 MO3
Synonyms: myh6 morpholino blocking 1st coding exon splice donor
mRNA Target: myh6

Morpholino Type: uncategorized morpholino
Sequence:
5' CTTATAAATGTAATACCTTGCCATC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' GATGGCAAGGTATTACATTTATAAG 3' ||||||||||||||||||||||||| 3' CTACCGTTCCATAATGTAAATATTC 5' 5' GATGGCAAGGTATTACATTTATAAG 3' ||||||||||||||||||||||||| 3' CTACCGTTCCATAATGTAAATATTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold326511:684496..684520 25/25 Antisense target myh6.S
Scaffold307846:469770..469794 21/25 Sense off-target Xelaev16041553m
Scaffold36991:3437710..3437734 21/25 unknown
Scaffold54274:2285457..2285481 21/25 unknown
Scaffold99429:370168..370192 21/25 Sense off-target cul1.S
tropicalis 7.1 scaffold_1:85917888..85917912 25/25 Antisense target myh6
scaffold_3:87804493..87804517 21/25 Sense off-target rab3ip
Publications
First: Absence of heartbeat in the Xenopus tropicalis mutation muzak is caused by a nonsense mutation in cardiac myosin myh6., Dev Biol 2009              
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556