Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249945

Morpholino Name: myo10.2 MO5
Synonyms: Myo10, Myo10 MO
mRNA Target: myo10.2

Morpholino Type: uncategorized morpholino
Sequence:
5' TATTCCTCCATGTCTCCCTCTGCTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold21603:1727380..1727404 25/25 Antisense off-target Xelaev16027767m
Scaffold127187:1893200..1893224 24/25 Antisense off-target Xelaev16007784m
Scaffold343399:105636..105660 21/25 Antisense off-target Xelaev16044913m
Scaffold377:1210325..1210349 21/25 unknown
tropicalis 7.1 scaffold_25:282888..282912 22/25 unknown
scaffold_2:130373427..130373451 21/25 unknown
scaffold_9:3193080..3193104 21/25 unknown
scaffold_97:70775..70799 21/25 unknown
Publications
First: Myosin-10 and actin filaments are essential for mitotic spindle function., J Cell Biol 2008                  
Most recent: An interaction between myosin-10 and the cell cycle regulator Wee1 links spindle dynamics to mitotic progression in epithelia., J Cell Biol 2018                  
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556