Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249949

Morpholino Name: myod1 MO1
Synonyms: XMyoDa
mRNA Target: myod1

Morpholino Type: uncategorized morpholino
Sequence:
5' ACAGCTCCATAGCAACAGCGCAAAG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 24/25
genomic

MO
5' CTTTGCGCCGTTGCTATGGAGCTGT 3' |||||||| |||||||||||||||| 3' GAAACGCGACAACGATACCTCGACA 5' 5' CTTTGCGCTGTTTCTATGGAGCTGT 3' |||||||||||| |||||||||||| 3' GAAACGCGACAACGATACCTCGACA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold93786:273645..273669 24/25 Antisense target myod1.S
Scaffold169907:4035277..4035301 21/25 unknown
Scaffold36864:1157061..1157085 21/25 unknown
Scaffold42478:717782..717806 21/25 Sense off-target Xelaev16052569m
tropicalis 7.1 scaffold_4377:1594..1618 24/25 Antisense target myod1
scaffold_6:141459348..141459372 22/25 unknown
scaffold_6:141481610..141481634 22/25 unknown
scaffold_2:69567327..69567351 21/25 unknown
scaffold_2:92082837..92082861 21/25 unknown
scaffold_4:11414206..11414230 21/25 unknown
scaffold_5:16451423..16451447 21/25 Sense off-target mynn
scaffold_5:16502243..16502267 21/25 unknown
scaffold_5:16502371..16502395 21/25 unknown
scaffold_5:53697099..53697123 21/25 Sense off-target cep85l
scaffold_5:74284755..74284779 21/25 Sense off-target cnst
scaffold_7:55640788..55640812 21/25 unknown
Publications
First: Early transcriptional targets of MyoD link myogenesis and somitogenesis., Dev Biol 2012                                                      
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556