Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249949

Morpholino Name: myod1 MO1
Synonyms: XMyoDa
Target mRNA: myod1

Morpholino Type: uncategorized morpholino
Sequence: 5' ACAGCTCCATAGCAACAGCGCAAAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 24/25
genomic

MO
5' CTTTGCGCCGTTGCTATGGAGCTGT 3' |||||||| |||||||||||||||| 3' GAAACGCGACAACGATACCTCGACA 5' 5' CTTTGCGCTGTTTCTATGGAGCTGT 3' |||||||||||| |||||||||||| 3' GAAACGCGACAACGATACCTCGACA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr4S:22717238..22717262 24/25 Antisense target myod1.S
Scaffold57:586329..586353 21/25 unknown
chr1S:178794881..178794905 21/25 unknown
chr8L:16217270..16217294 21/25 unknown
tropicalis 10.0 Chr4:902738..902762 24/25 Antisense target myod1
Chr6:3029899..3029923 22/25 Antisense off-target LOC105947723
Chr6:3054879..3054903 22/25 Antisense off-target LOC549508
Chr5:112144337..112144361 21/25 Sense off-target mynn
Chr5:51450063..51450087 21/25 Sense off-target cnst
Chr5:73784290..73784314 21/25 Sense off-target cep85l
Chr7:55572614..55572638 21/25 Sense off-target clp1
Chr7:68335222..68335246 21/25 Sense off-target opcml
Chr5:112144209..112144233 21/25 Antisense off-target mynn
Chr2:125998051..125998075 21/25 unknown
Chr2:147913905..147913929 21/25 unknown
Publications
First: Early transcriptional targets of MyoD link myogenesis and somitogenesis., Dev Biol 2012                                                      
Most recent:
View All Papers