Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249950

Morpholino Name: myod1 MO2
Synonyms: XMyoDb
mRNA Target: myod1

Morpholino Type: uncategorized morpholino
Sequence:
5' GTCCCAGGCCAAATACCCGCAGTTTG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/26
genomic

MO
5' CAAACTGCGGGTATTTGGCCTGGACC 3' ||||||||||||||||||||||| | 3' GTTTGACGCCCATAAACCGGACCCTG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold47091:1691239..1691264 24/26 Antisense target myod1.L
tropicalis 7.1 scaffold_543:13343..13368 23/26 Antisense off-target eif4g3
scaffold_543:13447..13472 23/26 Antisense off-target eif4g3
scaffold_543:13551..13576 23/26 Antisense off-target eif4g3
scaffold_543:13655..13680 23/26 Antisense off-target eif4g3
scaffold_543:13759..13784 23/26 Antisense off-target eif4g3
Publications
First: Early transcriptional targets of MyoD link myogenesis and somitogenesis., Dev Biol 2012                                                      
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556