Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249950

Morpholino Name: myod1 MO2
Synonyms: XMyoDb
Target mRNA: myod1

Morpholino Type: uncategorized morpholino
Sequence: 5' GTCCCAGGCCAAATACCCGCAGTTTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/26
genomic

MO
5' CAAACTGCGGGTATTTGGCCTGGACC 3' ||||||||||||||||||||||| | 3' GTTTGACGCCCATAAACCGGACCCTG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr4L:406223..406248 24/26 Antisense target myod1.L
tropicalis 10.0 Chr7:132833323..132833348 23/26 Antisense off-target eif4g3
Chr7:132833427..132833452 23/26 Antisense off-target eif4g3
Chr7:132833531..132833556 23/26 Antisense off-target eif4g3
Chr7:132833635..132833660 23/26 Antisense off-target eif4g3
Chr7:132833739..132833764 23/26 Antisense off-target eif4g3
Publications
First: Early transcriptional targets of MyoD link myogenesis and somitogenesis., Dev Biol 2012                                                      
Most recent:
View All Papers