Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249954

Morpholino Name: n4bp3 MO1
Synonyms: n4bp3 MO
mRNA Target: n4bp3

Morpholino Type:
Sequence:
5' CAATCAGGCTGCTTACACTTCCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' ATGGGAAGTGTAAGCAGCCTAATTG 3' |||||||||||||||||||| |||| 3' TACCCTTCACATTCGTCGGACTAAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold100253:2609842-2609866 25/25 Antisense off-target Xelaev16000110m
Scaffold5925:9746939-9746963 23/25 Antisense off-target Xelaev16064894m
Scaffold60608:874634-874658 21/25 Sense off-target Xelaev16065697m
Scaffold96766:1082366-1082390 21/25 Sense off-target Xelaev16080083m
tropicalis 7.1 scaffold_3:76573593-76573617 24/25 Antisense target n4bp3
scaffold_10:1722173-1722197 21/25 Antisense off-target dnah9
scaffold_277:108151-108175 21/25 unknown
Publications
First: The Nedd4-binding protein 3 (N4BP3) is crucial for axonal and dendritic branching in developing neurons. [Neural Dev 2013]
Most recent: The Nedd4 binding protein 3 is required for anterior neural development in Xenopus laevis. [Dev Biol 2017]
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556