Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249954

Morpholino Name: n4bp3 MO1
Synonyms: n4bp3 MO
mRNA Target: n4bp3

Morpholino Type: uncategorized morpholino
Sequence:
5' CAATCAGGCTGCTTACACTTCCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25 23/25
genomic

MO
5' ATGGGAAGTGTAAGCAGCCTAATTG 3' |||||||||||||||||||| |||| 3' TACCCTTCACATTCGTCGGACTAAC 5' 5' ATGGGAAGTGTAAGCAGCCTGATTG 3' ||||||||||||||||||||||||| 3' TACCCTTCACATTCGTCGGACTAAC 5' 5' ATGGGAAATGTAAGCAGCCTGATGG 3' ||||||| ||||||||||||||| | 3' TACCCTTCACATTCGTCGGACTAAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:40648115..40648139 25/25 Antisense target n4bp3.L
chr3S:97428162..97428186 23/25 Antisense target n4bp3.S
chr9_10L:112863546..112863570 21/25 Sense off-target sec14l1.L
chr9_10S:48702760..48702784 21/25 Sense off-target thsd7b.S
tropicalis 10.0 Chr3:47790651..47790675 24/25 Antisense target n4bp3
Chr10:47440805..47440829 21/25 Antisense off-target dnah9
Chr3:7223439..7223463 21/25 Sense off-target large1
Publications
First: The Nedd4-binding protein 3 (N4BP3) is crucial for axonal and dendritic branching in developing neurons., Neural Dev 2013                      
Most recent: The Nedd4 binding protein 3 is required for anterior neural development in Xenopus laevis., Dev Biol 2017                              
View All Papers