Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249955

Morpholino Name: naca.2 MO1
Synonyms: 24B12.1moA
mRNA Target: naca

Morpholino Type:
Sequence:
5' AGCTGGGACAGTTTCTGTGGCTTCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' TGAAGCCACAGAAACTGTCCCAGCT 3' ||||||||||||||||||||||||| 3' ACTTCGGTGTCTTTGACAGGGTCGA 5' 5' TGAAGCCACAGAAACTGTCCCAGCT 3' ||||||||||||||||||||||||| 3' ACTTCGGTGTCTTTGACAGGGTCGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold14978:585540..585564 25/25 Antisense off-target Xelaev16014294m
Scaffold8129:8968499..8968523 25/25 Antisense target naca.2.L
Scaffold167628:4915734..4915758 21/25 unknown
Scaffold17127:292753..292777 21/25 Antisense off-target Xelaev16020277m
Scaffold23872:5294017..5294041 21/25 unknown
Scaffold399803:302899..302923 21/25 Sense off-target Xelaev16051241m
Scaffold53017:480822..480846 21/25 unknown
Scaffold69443:6814955..6814979 21/25 Sense off-target Xelaev16068967m
Scaffold93416:577861..577885 21/25 unknown
tropicalis 7.1 scaffold_2:82088903..82088927 25/25 Antisense target naca.2
Publications
First: Pilot morpholino screen in Xenopus tropicalis identifies a novel gene involved in head development. [Dev Dyn 2004]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.0
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556