Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249957

Morpholino Name: nap1l1 MO1
Synonyms: xNAP1L morpholino
mRNA Target: nap1l1

Morpholino Type:
Sequence:
5' TATGTTAGCCATTATGTTGAGCACC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 22/25 23/25
genomic

MO
5' GGTGCTGAACAGAATGGCTAACATA 3' |||||| |||| ||||||||||||| 3' CCACGAGTTGTATTACCGATTGTAT 5' 5' GGTGCTGAATAAAATGGCTAACATA 3' |||||| || | ||||||||||||| 3' CCACGAGTTGTATTACCGATTGTAT 5' 5' GGTGCTGAACATAATGGCTACCATA 3' |||||| ||||||||||||| |||| 3' CCACGAGTTGTATTACCGATTGTAT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold193150:2038141-2038165 23/25 Antisense target nap1l1.S
Scaffold30470:6922532-6922556 22/25 Antisense target nap1l1.L
tropicalis 7.1 scaffold_3:89824201-89824225 23/25 Antisense target nap1l1
scaffold_9:28933101-28933125 21/25 Sense off-target nbeal1
Publications
First: Zygotic nucleosome assembly protein-like 1 has a specific, non-cell autonomous role in hematopoiesis. [Blood 2005]
Most recent: Identification of a structural and functional domain in xNAP1 involved in protein-protein interactions. [Nucleic Acids Res 2006]
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556