Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249958

Morpholino Name: ncam1 MO1
Synonyms: NCAM
mRNA Target: ncam1

Morpholino Type:
Sequence:
5' AGATGAGATCCTTAATGTGCAGCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATGCTGCACATTAAGGATCTCATCT 3' ||||||||||||||||||||||||| 3' TACGACGTGTAATTCCTAGAGTAGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold154389:1508375..1508399 25/25 Antisense target ncam1.S
Scaffold66475:3486415..3486439 25/25 Antisense off-target Xelaev16067802m
Scaffold245384:866872..866896 22/25 unknown
Scaffold3267:1306008..1306032 21/25 unknown
Scaffold376454:746603..746627 21/25 Sense off-target Xelaev16049032m
Scaffold41091:105421..105445 21/25 unknown
tropicalis 7.1 scaffold_7:78367048..78367072 24/25 unknown
scaffold_1:184721157..184721181 21/25 unknown
scaffold_6:92966274..92966298 21/25 unknown
scaffold_7:19732212..19732236 21/25 unknown
scaffold_7:32233151..32233175 21/25 unknown
Publications
First: Retinal patterning by Pax6-dependent cell adhesion molecules. [Dev Neurobiol 2010]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556