Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249959

Morpholino Name: ncor2 MO1
Synonyms: X.tropicalis exon 37b splice donor
mRNA Target: ncor2

Morpholino Type: uncategorized morpholino
Sequence:
5' GTATGTCTTACCATCACTATTGGCG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' CGCCAATAGTGATGGTAAGACATAC 3' ||||||||||||||||||||||||| 3' GCGGTTATCACTACCATTCTGTATG 5' 5' CGCCAATAGTGATGGTAAGACATAC 3' ||||||||||||||||||||||||| 3' GCGGTTATCACTACCATTCTGTATG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold167265:168896..168920 25/25 Antisense target ncor2.S
Scaffold89040:1732444..1732468 23/25 Antisense off-target Xelaev16077651m
tropicalis 7.1 scaffold_1:47491198..47491222 25/25 Antisense target ncor2
Publications
First: Xenopus embryos lacking specific isoforms of the corepressor SMRT develop abnormal heads., Dev Biol 2006                      
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556