Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249960

Morpholino Name: ndp MO1
Synonyms: xNor-MO
mRNA Target: ndp

Morpholino Type: uncategorized morpholino
Sequence:
5' CTCAATCCCAGTCTTCCTTTCAGGT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' ACCTGAGAGGAAGACTGGGATTAAG 3' |||||| ||||||||||||||| || 3' TGGACTTTCCTTCTGACCCTAACTC 5' 5' ACCTGAAAGGAAGACTGGGATTGAG 3' ||||||||||||||||||||||||| 3' TGGACTTTCCTTCTGACCCTAACTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold35524:2106770..2106794 25/25 Antisense target ndp.S
Scaffold7331:1262351..1262375 23/25 Antisense off-target Xelaev16070649m
Scaffold81267:976927..976951 22/25 unknown
Scaffold46073:1840547..1840571 21/25 Sense off-target Xelaev16055825m
Scaffold7197:810905..810929 21/25 Antisense off-target csk.S
tropicalis 7.1 scaffold_2:55613447..55613471 23/25 Antisense target ndp
scaffold_6:58908378..58908402 23/25 unknown
scaffold_10:23258480..23258504 22/25 unknown
scaffold_1001:6119..6143 22/25 unknown
scaffold_487:25742..25766 22/25 unknown
scaffold_487:60119..60143 22/25 unknown
scaffold_487:8965..8989 22/25 unknown
scaffold_9:31645713..31645737 22/25 unknown
scaffold_2:24040537..24040561 21/25 unknown
Publications
First: Maternal xNorrin, a canonical Wnt signaling agonist and TGF-β antagonist, controls early neuroectoderm specification in Xenopus., PLoS Biol 2012                                      
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556