Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249961

Morpholino Name: ndp MO2
Synonyms: Xnore-spMO, xNor-spMO
mRNA Target: ndp

Morpholino Type: uncategorized morpholino
Sequence:
5' TTAAAGTGGACTGTACCTTGGCAGT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ACTGCCAAGGTACAGTCCACTTTAA 3' ||||||||||||||||||||||||| 3' TGACGGTTCCATGTCAGGTGAAATT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold35524:2107013..2107037 25/25 Antisense target ndp.S
Scaffold21603:5129892..5129916 21/25 unknown
tropicalis 7.1 scaffold_1:115077731..115077755 22/25 Antisense off-target svep1
scaffold_5:115768339..115768363 21/25 unknown
scaffold_7:106360332..106360356 21/25 unknown
scaffold_8:84259059..84259083 21/25 Antisense off-target tmem151b
Publications
First: Maternal xNorrin, a canonical Wnt signaling agonist and TGF-β antagonist, controls early neuroectoderm specification in Xenopus., PLoS Biol 2012                                      
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556