Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249962

Morpholino Name: ndrg1 MO1
Synonyms: ndrg1a MO2
mRNA Target: ndrg1

Morpholino Type: uncategorized morpholino
Sequence:
5' ATACCCTGGTGTCCTGATGCTGCGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 25/25 21/25
genomic

MO
5' GCGCAGCATCAGGACACCAGGATAC 3' ||||||||||||||||||||| || 3' CGCGTCGTAGTCCTGTGGTCCCATA 5' 5' GCGCAGCATCAGGACACCAGGGTAT 3' ||||||||||||||||||||||||| 3' CGCGTCGTAGTCCTGTGGTCCCATA 5' 5' GCGCAGCAACAGGACACCAGCGTGC 3' |||||||| ||||||||||| || 3' CGCGTCGTAGTCCTGTGGTCCCATA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold43791:5905399..5905423 25/25 Antisense target ndrg1.L
Scaffold230550:3980210..3980234 21/25 unknown
Scaffold237598:2682173..2682197 21/25 Antisense target ndrg1.S
tropicalis 7.1 scaffold_6:5466534..5466558 23/25 Antisense target ndrg1
Publications
First: Retinoic acid-activated Ndrg1a represses Wnt/β-catenin signaling to allow Xenopus pancreas, oesophagus, stomach, and duodenum specification., PLoS One 2013                  
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556