Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249963

Morpholino Name: ndrg1 MO2
Synonyms: ndrg1a MO1
mRNA Target: ndrg1

Morpholino Type: uncategorized morpholino
Sequence:
5' ATAGCCGTTTGCCTGTGTAAGAAGA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold15893:5354841..5354865 21/25 unknown
tropicalis 7.1 scaffold_4:126639178..126639202 21/25 unknown
Publications
First: Retinoic acid-activated Ndrg1a represses Wnt/β-catenin signaling to allow Xenopus pancreas, oesophagus, stomach, and duodenum specification., PLoS One 2013                  
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556