Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249973

Morpholino Name: neurog2 MO1
Synonyms: Ngnr1 MO
Target mRNA: neurog2

Morpholino Type: uncategorized morpholino
Sequence: 5' GTACTCGCACTTGAGCAGCACCATC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 23/25
genomic

MO
5' GATGGTGCTGCTGAAGTGCGAGTAC 3' |||||||||||| |||||||||||| 3' CTACCACGACGAGTTCACGCTCATG 5' 5' GATGGTGCTGCTCAAGTGCGAGTAC 3' ||||||||||||||||||||||||| 3' CTACCACGACGAGTTCACGCTCATG 5' 5' GATGGTGCTGCTGAAGTGCGAATAC 3' |||||||||||| |||||||| ||| 3' CTACCACGACGAGTTCACGCTCATG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1L:61888265..61888289 25/25 Antisense target neurog2.L
chr1S:56723847..56723871 23/25 Antisense target neurog2.S
chr6L:122895824..122895848 21/25 unknown
tropicalis 10.0 Chr1:68901722..68901746 24/25 Antisense target neurog2
Publications
First: Xenopus zinc finger transcription factor IA1 (Insm1) expression marks anteroventral noradrenergic neuron progenitors in Xenopus embryos., Dev Dyn 2008            
Most recent:
View All Papers