Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249974

Morpholino Name: neurog2 MO2
Synonyms: Ngnr1 MO1, X-ngnr-1-MO
Target mRNA: neurog2

Morpholino Type: uncategorized morpholino
Sequence: 5' TGGTTAGCCCCAATGTTGCACTGAC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GTCAGTGCAACATTGGGGCTAACCA 3' ||||||||||||||||||||||||| 3' CAGTCACGTTGTAACCCCGATTGGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1L:61888316..61888340 25/25 Antisense target neurog2.L
Publications
First: Mxi1 is essential for neurogenesis in Xenopus and acts by bridging the pan-neural and proneural genes., Dev Biol 2006                  
Most recent: KDM3A-mediated demethylation of histone H3 lysine 9 facilitates the chromatin binding of Neurog2 during neurogenesis., Development 2017                            
View All Papers