Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249987

Morpholino Name: nif MO1
Synonyms: XNIF
mRNA Target: nif

Morpholino Type: uncategorized morpholino
Sequence:
5' CGAAGTGTAGAGCTCCCTGGAAGTCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/26
genomic

MO
5' TGACTTCCAGGGAGCTCTACACTTCA 3' ||||||||||||||||||||||||| 3' ACTGAAGGTCCCTCGAGATGTGAAGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold14870:304629..304654 25/26 Antisense off-target nif.S
Scaffold247724:1739534..1739559 25/26 Antisense target nif.L
Scaffold155530:1196533..1196558 22/26 unknown
Publications
First: hnRNP K post-transcriptionally co-regulates multiple cytoskeletal genes needed for axonogenesis., Development 2011                  
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556