Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249988

Morpholino Name: nipbl MO1
Synonyms: Nipbl, TEgg076c16, delangin
mRNA Target: nipbl

Morpholino Type:
Sequence:
5' AGCTGTAGGATGGTGGTATCTATGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' GCGTAGATACCACCATCCTACAGCT 3' || |||||||||||||||||||||| 3' CGTATCTATGGTGGTAGGATGTCGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold51452:1372253-1372277 25/25 Antisense off-target Xelaev16059009m
Scaffold52441:6111665-6111689 24/25 Antisense target nipbl.S
tropicalis 7.1 scaffold_1:27295716-27295740 25/25 unknown
Publications
First: Metazoan Scc4 homologs link sister chromatid cohesion to cell and axon migration guidance. [PLoS Biol 2006]
Most recent: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556