Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249993

Morpholino Name: nkx2-5 MO1
Synonyms: nkx2.5 MO
mRNA Target: nkx2-5

Morpholino Type: uncategorized morpholino
Sequence:
5' GGATGTCACAGGACTGGCAAACATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 23/25 25/25
genomic

MO
5' CATGTTTGCCAGCCCTGTGACTTCC 3' |||||||||||| |||||||| ||| 3' GTACAAACGGTCAGGACACTGTAGG 5' 5' CATGTTTGCCAGCCCTGTGACTTCC 3' |||||||||||| |||||||| ||| 3' GTACAAACGGTCAGGACACTGTAGG 5' 5' CATGTTTGCCAGTCCTGTGACATCC 3' ||||||||||||||||||||||||| 3' GTACAAACGGTCAGGACACTGTAGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3S:101591541..101591565 25/25 Antisense target nkx2-5.S
chr3L:36587581..36587605 23/25 Antisense target nkx2-5.L
chr3L:36594053..36594077 23/25 Antisense target nkx2-5.L
Scaffold20:5102748..5102772 22/25 Antisense off-target LOC108703541
tropicalis 10.0 Chr3:43398346..43398370 23/25 Antisense target nkx2-5
Chr3:126540349..126540373 21/25 Sense off-target gck
Publications
First: HIF-1alpha signaling upstream of NKX2.5 is required for cardiac development in Xenopus., J Biol Chem 2008                          
Most recent: Nkx2.5 is involved in myeloid cell differentiation at anterior ventral blood islands in the Xenopus embryo., Dev Growth Differ 2014                
View All Papers