Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249997

Morpholino Name: nkx6-1 MO3
Synonyms: nkx6.1
mRNA Target: nkx6-1

Morpholino Type: uncategorized morpholino
Sequence:
5' TAGCGTTAATCAGTACAGGTGGTAG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CTACCACCTGTACTGATTAACGCTA 3' ||||||||||||||||||||||||| 3' GATGGTGGACATGACTAATTGCGAT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold101214:13794..13818 25/25 Antisense target nkx6-1.L
Scaffold62229:3461633..3461657 21/25 unknown
tropicalis 7.1 scaffold_6:72829822..72829846 21/25 unknown
Publications
First: Xenopus Nkx6.1 and Nkx6.2 are required for mid-hindbrain boundary development., Dev Genes Evol 2013  
Most recent: Prdm12 specifies V1 interneurons through cross-repressive interactions with Dbx1 and Nkx6 genes in Xenopus., Development 2015                                      
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556