Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250002

Morpholino Name: nodal1 MO1
Synonyms: Xnr1 MOb
mRNA Target: nodal1

Morpholino Type: uncategorized morpholino
Sequence:
5' GCACTGCTGATCTCTCTTTCAGGGA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TCCCTGAAAGAGAGATCAGCAGTGC 3' ||||||||||||||||||||||||| 3' AGGGACTTTCTCTCTAGTCGTCACG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold171831:210533..210557 25/25 Antisense target nodal1.L
Scaffold59267:2177669..2177693 23/25 Antisense off-target Xelaev16065126m
Scaffold325141:2225342..2225366 22/25 unknown
Scaffold12423:660037..660061 21/25 unknown
tropicalis 7.1 scaffold_4:81323786..81323810 22/25 unknown
scaffold_9:46329383..46329407 21/25 unknown
Publications
First: Distinct Xenopus Nodal ligands sequentially induce mesendoderm and control gastrulation movements in parallel to the Wnt/PCP pathway., Development 2010            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556