Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250002

Morpholino Name: nodal1 MO1
Synonyms: Xnr1 MOb
Target mRNA: nodal1

Morpholino Type: uncategorized morpholino
Sequence: 5' GCACTGCTGATCTCTCTTTCAGGGA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25
genomic

MO
5' TCCCTGAAAGAGAGATCAGCAGTGC 3' ||||||||||||||||||||||||| 3' AGGGACTTTCTCTCTAGTCGTCACG 5' 5' TTCCTGGAAGAGAGATCAGCAGTGC 3' | |||| |||||||||||||||||| 3' AGGGACTTTCTCTCTAGTCGTCACG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:125376039..125376063 25/25 Antisense target nodal1.L
chr3S:20865499..20865523 23/25 Antisense target nodal1.S
chr3L:125376039..125376063 25/25 Sense off-target star.L
chr4L:81543677..81543701 22/25 Sense off-target LOC108714277
chr4S:92746260..92746284 21/25 unknown
tropicalis 10.0 Chr4:116593718..116593742 22/25 Sense off-target LOC116410448
Chr9:58793795..58793819 21/25 unknown
Publications
First: Distinct Xenopus Nodal ligands sequentially induce mesendoderm and control gastrulation movements in parallel to the Wnt/PCP pathway., Development 2010            
Most recent:
View All Papers