Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250003

Morpholino Name: nodal1 MO2
Synonyms: Xnr-1 MO-1, Xnr-1 MO1
mRNA Target: nodal1

Morpholino Type: uncategorized morpholino
Sequence:
5' ACAGGACTGCTGTCAGAAATGCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' ATGGCATTTCTGACAGCAGTCCTGT 3' ||||||||||||||||||||||||| 3' TACCGTAAAGACTGTCGTCAGGACA 5' 5' ATGGCATTTCTGACAGCAGTCCTGT 3' ||||||||||||||||||||||||| 3' TACCGTAAAGACTGTCGTCAGGACA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold171831:210562..210586 25/25 Antisense target nodal1.L
Scaffold59267:2177698..2177722 25/25 Antisense off-target Xelaev16065126m
Scaffold137879:83238..83262 23/25 Antisense off-target lamp2.S
Scaffold122317:763..787 21/25 unknown
Scaffold196047:69..93 21/25 unknown
Scaffold226594:908559..908583 21/25 unknown
Scaffold24235:1334359..1334383 21/25 Antisense off-target Xelaev16032014m
Scaffold282487:11870..11894 21/25 unknown
Scaffold36864:4105508..4105532 21/25 Antisense off-target Xelaev16047989m
Scaffold46631:936403..936427 21/25 unknown
Scaffold50079:4625414..4625438 21/25 unknown
Scaffold54451:1151..1175 21/25 unknown
Scaffold61124:6676823..6676847 21/25 unknown
Scaffold8129:6068181..6068205 21/25 unknown
tropicalis 7.1 scaffold_3:5678104..5678128 25/25 Antisense target nodal1
scaffold_6:110650309..110650333 21/25 unknown
scaffold_8:22407927..22407951 21/25 Antisense off-target hsf3
Publications
First: Xenopus nodal related-1 is indispensable only for left-right axis determination., Int J Dev Biol 2005                  
Most recent: Distinct Xenopus Nodal ligands sequentially induce mesendoderm and control gastrulation movements in parallel to the Wnt/PCP pathway., Development 2010            
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556