Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250003

Morpholino Name: nodal1 MO2
Synonyms: Xnr-1 MO-1, Xnr-1 MO1
Target mRNA: nodal1

Morpholino Type: uncategorized morpholino
Sequence: 5' ACAGGACTGCTGTCAGAAATGCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' ATGGCATTTCTGACAGCAGTCCTGT 3' ||||||||||||||||||||||||| 3' TACCGTAAAGACTGTCGTCAGGACA 5' 5' ATGGCATTTCTGACAGCAGTCCTGT 3' ||||||||||||||||||||||||| 3' TACCGTAAAGACTGTCGTCAGGACA 5' 5' ATGGCATTTCTGACAGCAGTCCTGT 3' ||||||||||||||||||||||||| 3' TACCGTAAAGACTGTCGTCAGGACA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:125376068..125376092 25/25 Antisense target nodal1.L
chr3S:20865470..20865494 25/25 Antisense target nodal1.S
chr3L:125376068..125376092 25/25 Sense off-target star.L
chr8S:56065021..56065045 23/25 Antisense off-target lamp2.S
Scaffold309:20449..20473 21/25 Antisense off-target hsf3.1
chr4L:61182689..61182713 21/25 Sense off-target mylk3.L
Scaffold309:1533..1557 21/25 Antisense off-target LOC108705658 [provisional:hsf3]
chr8S:84778383..84778407 21/25 Antisense off-target plekhg2.S
chr4S:51908907..51908931 21/25 Antisense off-target ddah1.S
chr8L:13268823..13268847 21/25 Antisense off-target LOC108698253 [provisional:hsf3]
Scaffold6472:85..109 21/25 unknown
chr2S:118514960..118514984 21/25 unknown
chr6L:32278795..32278819 21/25 unknown
chr7S:47082141..47082165 21/25 unknown
tropicalis 10.0 Chr3:132122716..132122740 25/25 Antisense target nodal1
Chr6:34752587..34752611 21/25 Sense off-target nxph1
Chr8:40811679..40811703 21/25 Sense off-target ngrn
Chr8:40811679..40811703 21/25 Antisense off-target hsf3
Publications
First: Xenopus nodal related-1 is indispensable only for left-right axis determination., Int J Dev Biol 2005                  
Most recent: Distinct Xenopus Nodal ligands sequentially induce mesendoderm and control gastrulation movements in parallel to the Wnt/PCP pathway., Development 2010            
View All Papers